Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_104689 | |||
Gene | ASAP1 | Organism | Human |
Genome Locus | chr8:131164981-131181313:- | Build | hg19 |
Disease | Breast Cancer | ICD-10 | Malignant neoplasm of breast (C50) |
DBLink | Link to database | PMID | 28484086 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Breast cancer lesions and adjacent normal-appearing tissues were collected from patients who underwent surgical breast resection |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGGCAGTGAAAAGAAGGGGT ReverseTGAAAGAAATGTGGCATGTGAGA | Statistics | Fold Change : Upregulated pvalue : p=0.041 |
Citation | |||
Lu, L, Sun, J, Shi, P, Kong, W, Xu, K, He, B, Zhang, S, Wang, J (2017). Identification of circular RNAs as a promising new class of diagnostic biomarkers for human breast cancer. Oncotarget, 8, 27:44096-44107. |